|  Help  |  About  |  Contact Us

Allele : Borcs5<em1Jusb> BLOC-1 related complex subunit 5; endonuclease-mediated mutation 1, Juan S Bonifacino

Primary Identifier  MGI:6510587 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Borcs5
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with two sgRNAs (targeting ATCTTGGCCCGATGTTTAGC and GGCTAAACATCGGGCCAAGA) using CRISPR/Cas9 technology, resulting in a 10 bp deletion (GATGGACGAT) that leads to a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • myrlysin-KO,
  • myrlysin-KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele