| Primary Identifier | MGI:6513989 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Dhdds |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A single A-to-G mutation was introduced to change codon 42 from lysine (AAG) to glutamic acid (GAG) (p.K42E), using a gRNA (targeting TCGCTATGCCAAGAAGTGTCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics one associated with an autosomal recessive form of retinitis pigmentosa (RP59) in humans. |
