|  Help  |  About  |  Contact Us

Allele : Syisl<em1Bzuo> Synpo2 intron sense-overlapping lncRNA; endonuclease-mediated mutation 1, Bo Zuo

Primary Identifier  MGI:6511001 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Syisl
Strain of Origin  Not Specified Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 technology using sgRNAs ATGCTTTCGCCATAAGACAGTGG and CCACTATCCTATTAAAATATTAC deleted a 1133 bp region containing most of the transcript.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories