| Primary Identifier | MGI:6508702 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Nlrc4 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Serine codon 533 (TCA) was targeted with an sgRNA (targeting CTCTGGAGGCAGGAATCAAT) and ssODN templates using CRISPR/Cas9 technology, changing it to alanine codon GCA (p.S533A). This mutation renders the encoded peptide nonphosphorylatable at this residue. Western blot experiments confirmed the expression of peptides from this allele. |
