|  Help  |  About  |  Contact Us

Allele : Mcu<em1Muma> mitochondrial calcium uniporter; endonuclease-mediated mutation 1, Muniswamy Madesh

Primary Identifier  MGI:6515815 Allele Type  Endonuclease-mediated
Gene  Mcu Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
molecularNote  A mutation that changes codon 96 from cysteine (TGC) to alanine (GCC) (p.C96A) was created with two gRNAS (targeting GAGAGCTGCGCTCGCGACGGTTA and AAGCCTATCTCTGACTCAGTCGG) and an ssODN template using CRISPR/Cas9 technology. The mutation mimics the human p.C97A gain-of-function mutation that results in a hyperactivated channel activity.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • MCU-C96A-KI,
  • MCU-C96A-KI
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories