|  Help  |  About  |  Contact Us

Allele : Gt(ROSA)26Sor<em1(CAG-Ikzf2,-tdTomato)Zyliu> gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Zhiyong Liu

Primary Identifier  MGI:6515768 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, Epitope tag, Inserted expressed sequence, Reporter Gene  Gt(ROSA)26Sor
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  Plasmids encoding a guide RNA (ACTCCAGTCTTTCTAGAAGA) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette and a 3xHA (hemaglutinin) C-terminal tagged Ikzf2 gene into the Gt(ROSA)26Sor locus. A viral 2A oligopeptide (T2A) self cleaving peptide, that mediates ribosomal skipping, fused to a red fluorescent protein sequence (tdTomato) was inserted downstream.
  • mutations:
  • Insertion
  • synonyms:
  • Rosa26-CAG-Loxp-stop-Loxp-Ikzf2*3xHA-T2A-Tdtomato,
  • Rosa26-CAG-Loxp-stop-Loxp-Ikzf2*3xHA-T2A-Tdtomato,
  • Rosa26-CAG-LSL-Ikzf2,
  • Rosa26-CAG-LSL-Ikzf2
Quick Links:
 
Quick Links:
 

1 Feature

Genome

1 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

1 Driven By

3 Publication categories