|  Help  |  About  |  Contact Us

Allele : Pdzd8<em1Kei> PDZ domain containing 8; endonuclease-mediated mutation 1, Keiichi I Nakayama

Primary Identifier  MGI:6515784 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pdzd8
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 1 was targeted with two sgRNAs (targeting GCAGGCCGAGGGTTGCGGCGGGG and GCAGATTCCCAGCACGACCCTGG) and crRNA and tracrRNA using CRISPR/Cas9 technology. Immunohistochemistry confirmed the lack of peptide expression from this allele in brain.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Pdzd8<->,
  • Pdzd8<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories