| Primary Identifier | MGI:6690649 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm16685 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The genomic sequence containing two conserved NFKB-binding motifs, in the promoter upstream of the locus, was targeted with crRNAs (targeting AGGGTTTAAAAGCGCATCC and AGTCTGGGAGTTTCCGATCC) and tracrRNAs using CRISPR/Cas9 technology, resulting in an 79 bp deletion. RT-qPCR experiments confirmed the lack of transcript expression from this allele and hat there was no effect on the expression of the overlapping Il7 gene on the opposite strand. |
