|  Help  |  About  |  Contact Us

Allele : Gm16685<em1Osb> predicted gene, 16685; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Primary Identifier  MGI:6690649 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gm16685
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  The genomic sequence containing two conserved NFKB-binding motifs, in the promoter upstream of the locus, was targeted with crRNAs (targeting AGGGTTTAAAAGCGCATCC and AGTCTGGGAGTTTCCGATCC) and tracrRNAs using CRISPR/Cas9 technology, resulting in an 79 bp deletion. RT-qPCR experiments confirmed the lack of transcript expression from this allele and hat there was no effect on the expression of the overlapping Il7 gene on the opposite strand.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • mNAIL<deltaNFkappaB>,
  • mNAIL<deltaNFkappaB>,
  • Gm16685<em1Vter>,
  • Gm16685<em1Vter>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele