| Primary Identifier | MGI:7266270 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag, Reporter | Gene | Ddc |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A crRNA (AAUGAAAGCAGAGCUGCUUC) was designed to insert the Ddc40HA-V5-P2A-mRuby2-3xNLS construct immediately before the stop codon of the gene. Specifically, the construct contained (from 5'; to 3') the last 40 bp of Ddc coding sequence c-terminally conjugated with a V5 epitope tag, P2A self-cleaving peptide sequence, mRuby2 conjugated with three c-terminal copies of a nuclear localization sequence (3xNLS), stop codon, 37 bp of mutated Ddc 3'-UTR (mUTR) to prevent homology repair between the stop codon and a CRISPR cut site 34 bp downstream (preserving the 3';-splice junction of exon 14), followed by 40 bp of un-mutated Ddc intron 14 sequence. |
