| Primary Identifier | MGI:6693697 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Del(8Ddx19a-Ddx19b)2Chaw |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The 3' UTR of Ddx19a and intron 5 of Ddx19b were targeted with two sgRNAs (targeting CTGACAACTGCCAAGAATGGTGG and GGCTCAGAGGTTAAAAGCATGGG) using CRISPR/Cas9 technology, resulting in the deletion of 39,002 bp of sequence including the entire coding region of Ddx19a and the 3' end of Ddx19b. |