|  Help  |  About  |  Contact Us

Allele : Del(8Ddx19a-Ddx19b)2Chaw deletion, Chr 8, Changjiang Weng 2

Primary Identifier  MGI:6693697 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Del(8Ddx19a-Ddx19b)2Chaw
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The 3' UTR of Ddx19a and intron 5 of Ddx19b were targeted with two sgRNAs (targeting CTGACAACTGCCAAGAATGGTGG and GGCTCAGAGGTTAAAAGCATGGG) using CRISPR/Cas9 technology, resulting in the deletion of 39,002 bp of sequence including the entire coding region of Ddx19a and the 3' end of Ddx19b.
  • mutations:
  • Intragenic deletion,
  • Intergenic deletion
  • synonyms:
  • Ddx19-Delta39002,
  • Ddx19-Delta39002
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele