|  Help  |  About  |  Contact Us

Allele : Scgn<em2Ezb> secretagogin, EF-hand calcium binding protein; endonuclease-mediated mutation 2, Ezra Burstein

Primary Identifier  MGI:6711491 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Scgn
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The 3' end of exon 3 was targeted with an sgRNA (targeting AGGCCGCATACTGATGAAAGAGGT which includes the splice donor site) using CRISPR/Cas9 technology, resulting in a 30 bp deletion that includes exonic and intronic sequence and the exon 3 splice donor site. RT-PCR experiments show that owing to the deleted splice site, exon 3 is skipped during mRNA splicing. Immunofluorescence experiments confirm the absence of peptide expression from this allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Secret2,
  • Secret2
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories