| Primary Identifier | MGI:6695987 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Vps13b |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2 was targeted with two sgRNAs (targeting ACGCTTAAATTTGAAGATGCTGG and CGAGTTAAAGTTGGACGTTCTGG) using CRISPR/Cas9 technology, resulting in a 156 bp deletion that includes the start codon. Absence of exon 2 expression in the hippocampus was confirmed by RT-PCR. |
