|  Help  |  About  |  Contact Us

Allele : Vps13b<em1Yosl> vacuolar protein sorting 13B; endonuclease-mediated mutation 1, Yong-Seok Lee

Primary Identifier  MGI:6695987 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Vps13b
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with two sgRNAs (targeting ACGCTTAAATTTGAAGATGCTGG and CGAGTTAAAGTTGGACGTTCTGG) using CRISPR/Cas9 technology, resulting in a 156 bp deletion that includes the start codon. Absence of exon 2 expression in the hippocampus was confirmed by RT-PCR.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Vps13b<2->,
  • Vps13b<2->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories