|  Help  |  About  |  Contact Us

Allele : Tnfaip3<em2Ama> tumor necrosis factor, alpha-induced protein 3; endonuclease-mediated mutation 2, Averil Ma

Primary Identifier  MGI:6716904 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Tnfaip3
Transmission  Germline Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Codon changes to change phenylalanine 755 and glycine 756 to alanines (TTT>GCT (p.F755A), GGC>GCC (p.G756A)) were introduced using CRISPR/Cas9 technology with Alt-R CRISPR RNA (targeting GCCCCTGCTTGTGATCACTT), Alt-R trans-activating CRISPR RNA, high-fidelity Cas9 nuclease ribonucleoprotein and an ssODN template (ACGCCTGAAGAGCCCCCTAAACAGCGCTGCCGGGCCCCTGCTTGTGACCACGCTGCCAATGCCAAGTGTAATGGTTACTGCAATGAGTGCTACCAGTTCAAGCAGATGTATGG). This allele was generated in fertilized oocytes heterozygous for the Tnfaip3tm4.1Ama allele. Separate single-mutant for this Tnfaip3em2Ama allele and double-mutant mouse lines were subsequently established.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • A20<ZF7-FG>,
  • A20<ZF7-FG>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories