| Primary Identifier | MGI:6716904 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Tnfaip3 |
| Transmission | Germline | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Codon changes to change phenylalanine 755 and glycine 756 to alanines (TTT>GCT (p.F755A), GGC>GCC (p.G756A)) were introduced using CRISPR/Cas9 technology with Alt-R CRISPR RNA (targeting GCCCCTGCTTGTGATCACTT), Alt-R trans-activating CRISPR RNA, high-fidelity Cas9 nuclease ribonucleoprotein and an ssODN template (ACGCCTGAAGAGCCCCCTAAACAGCGCTGCCGGGCCCCTGCTTGTGACCACGCTGCCAATGCCAAGTGTAATGGTTACTGCAATGAGTGCTACCAGTTCAAGCAGATGTATGG). This allele was generated in fertilized oocytes heterozygous for the Tnfaip3tm4.1Ama allele. Separate single-mutant for this Tnfaip3em2Ama allele and double-mutant mouse lines were subsequently established. |
