| Primary Identifier | MGI:6716906 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Tnfaip3 |
| Transmission | Germline | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | A 9 bp in-frame deletion was introduced in the sequence encoding the 7th zinc finger using an sgRNA (targeting GCCCCTGCTTGTGATCACTTTGG) and an ssODN template with CRISPR/Cas9 technology. The deletion removes phenylanaline codon 755, glycine 756 and asparagine 757. |
