|  Help  |  About  |  Contact Us

Allele : Cr2<em1(CR2,CR1*)Adiuj)> complement receptor 2; endonuclease-mediated mutation 1, MODEL-AD Center

Primary Identifier  MGI:6717167 Allele Type  Endonuclease-mediated
Attribute String  Inserted expressed sequence Gene  Cr2
Strain of Origin  B6(SJL)-Cr2<tm1(CR2,CR1)How> Apoe<tm1.1(APOE*4)Adiuj> Trem2<em1Adiuj>/J Is Recombinase  false
Is Wild Type  false
molecularNote  Plasmids encoding guide RNAs (AAATCTGATGATCTCAGTGA and TAAATCTGATGATCTCAGTG) are designed to change ACC to TCA resulting in an threonine to serine mutation at amino acid 1610 (T1610S) in exon 29 of the human CR1 gene, which was previously inserted into the mouse Cr2 locus.
  • mutations:
  • Insertion,
  • Nucleotide substitutions
  • synonyms:
  • hCR1*T1610S,
  • hCR1*T1610S
Quick Links:
 
Quick Links:
 

1 Feature

Genome

2 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories