| Primary Identifier | MGI:6717167 | Allele Type | Endonuclease-mediated |
| Attribute String | Inserted expressed sequence | Gene | Cr2 |
| Strain of Origin | B6(SJL)-Cr2<tm1(CR2,CR1)How> Apoe<tm1.1(APOE*4)Adiuj> Trem2<em1Adiuj>/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Plasmids encoding guide RNAs (AAATCTGATGATCTCAGTGA and TAAATCTGATGATCTCAGTG) are designed to change ACC to TCA resulting in an threonine to serine mutation at amino acid 1610 (T1610S) in exon 29 of the human CR1 gene, which was previously inserted into the mouse Cr2 locus. |