| Primary Identifier | MGI:6726553 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tsga8 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2 was targeted with an sgRNA (targeting CCACGCTTGTTGGTCTTCGCACC) using CRISPR/Cas9 technology, resulting in a 2 bp insertion or duplication (TT). Immunohistochemistry and Western blot experiments confirm the absence of peptide expression from this allele in testes. |
