|  Help  |  About  |  Contact Us

Allele : Atxn7l1<em1(IMPC)J> ataxin 7-like 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6727371 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Atxn7l1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGTGATAACGATAAGCGG and TCTGGAGTGTAGCTGCAAGT, which resulted in a 478 bp deletion beginning at Chromosome 12 position 33,391,845 bp and ending after 33,392,322 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000655323 (exon 3) and 203 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 68.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories