| Primary Identifier | MGI:6718594 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ip6k1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 2, containing the ATG start codon, was targeted with two sgRNAs (targeting TTTGTCAAACCATGGAAGTGGGG and CCGCCCACCTGATGGATGAAGGG) using CRISPR/Cas9 technology, resulting in a 73 bp deletion. Absence of peptide expression from this allele was confirmed by immunoblot experiments with brain extracts. |
