| Primary Identifier | MGI:6756420 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr180 |
| Strain of Origin | C57BL/6 x DBA/2 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The H3K27ac regulatory (enhancer) element of the embryonic external genitalia (eExG) enhancer in the 3' UTR of Mafb was targeted with gRNAs (targeting TCTGTGAGTCCTGGCGGGTCCGG and TGCCGAGATCCACATCGTGCA) using CRISPR/Cas9 technology, resulting in a 1068 bp deletion. |
