|  Help  |  About  |  Contact Us

Allele : Rr180<em1Geny> regulatory region 180; endonuclease-mediated mutation 1, Gen Yamada

Primary Identifier  MGI:6756420 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr180
Strain of Origin  C57BL/6 x DBA/2 Is Recombinase  false
Is Wild Type  false
molecularNote  The H3K27ac regulatory (enhancer) element of the embryonic external genitalia (eExG) enhancer in the 3' UTR of Mafb was targeted with gRNAs (targeting TCTGTGAGTCCTGGCGGGTCCGG and TGCCGAGATCCACATCGTGCA) using CRISPR/Cas9 technology, resulting in a 1068 bp deletion.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Mafb<em1Geny>,
  • MafB<edelta>,
  • Mafb<em1Geny>,
  • MafB<edelta>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele