| Primary Identifier | MGI:6754164 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Tnfsf11 |
| Strain of Origin | (C57BL/6 x BALB/c)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Putative proximal enhancer sequence between -1413 and -510 bp upstream of the transcription start site (chr14:78545488 (build GRCm39)) was targeted with sgRNAs (targeting CAAGGTTTATAGGTGTTCTA and CCTCTCTTACGGGAGTCTAT) using CRISPR/Cas9 technology, resulting in a 909 bp deletion. |
