|  Help  |  About  |  Contact Us

Allele : Jak3<em1Jsca> Janus kinase 3; endonuclease-mediated mutation 1, J Simon C Arthur

Primary Identifier  MGI:6719599 Allele Type  Endonuclease-mediated
Gene  Jak3 Strain of Origin  C57BL/6NTac
Is Recombinase  false Is Wild Type  false
molecularNote  CRISPR/cas mediated recombination using a guide RNA (GGCGCTGCAGGAAGTCTCGCAGG) overlapping exon 20 introduced a Cys905Ser mutation. This mutation does not alter catalytic activity but greatly increases the IC50 for covalent JAK3 inhibitors.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Cys905Ser,
  • Cys905Ser
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories