| Primary Identifier | MGI:6719599 | Allele Type | Endonuclease-mediated |
| Gene | Jak3 | Strain of Origin | C57BL/6NTac |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/cas mediated recombination using a guide RNA (GGCGCTGCAGGAAGTCTCGCAGG) overlapping exon 20 introduced a Cys905Ser mutation. This mutation does not alter catalytic activity but greatly increases the IC50 for covalent JAK3 inhibitors. |
