| Primary Identifier | MGI:6727368 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Magi3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGTGTGAGAAAAACAC and TTTAGGAATGGAGCACAAAA, which resulted in a 7616 bp deletion beginning at Chromosome 3 position 103,956,433 bp and ending after 103,964,048 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000421484, ENSMUSE00000421384, ENSMUSE00000421452, and ENSMUSE00000421379 (exons 8-11) and 6694 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 361 and early truncation 14 amino acids later. |
