| Primary Identifier | MGI:6727352 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcdhga7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATGGCGCCTGGACAGAG and GGGTGAAGCCCCAAGTTCCC, which resulted in a 2435 bp deletion beginning at Chromosome 18 position 37,847,990 bp and ending after 37,850,424 bp (GRCm39/mm39). This mutation deletes 2435 bp from ENSMUSE00001346069 (exon 1) including the start site but leaves the last 3 nucleotides before the end of the exon, and is predicted to result in a null allele. |
