|  Help  |  About  |  Contact Us

Allele : Nanos2<em2Oat> nanos C2HC-type zinc finger 2; endonuclease-mediated mutation 2, Jon M Oatley

Primary Identifier  MGI:6754130 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nanos2
Is Recombinase  false Is Wild Type  false
molecularNote  The coding region was targeted with sgRNAs (targeting TGGACCTACCGCCCTTTGAC and AGTCTCTCTACCGACGCAGT) using CRISPR/Cas9 technology, resulting in a 368 bp deletion and 2 bp insertion (GA).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories