| Primary Identifier | MGI:6755467 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pdp2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCAGAATTGAAGATCCAGT and CCATGACAGTGATATCATCC, which resulted in a 1510 bp deletion beginning at Chromosome 8 position 105,320,175 bp and ending after 105,321,684 bp (GRCm39/mm39). This mutation deletes 1510 bp from ENSMUSE00000334359 (exon 2) and is predicted to cause a change of amino acid sequence after residue 7 and termination 41 amino acids later. |
