|  Help  |  About  |  Contact Us

Allele : 4933411K16Rik<em1(IMPC)J> RIKEN cDNA 4933411K16 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6740198 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  4933411K16Rik
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGTCTTCTGTAGTCTCAG and AGCCATAGATTGGGTTTCTG, which resulted in an 863 bp deletion beginning at Chromosome 19 position 42,040,905 bp and ending after 42,041,767 bp (GRCm39/mm39). This mutation deletes 863 bp of ENSMUSE00000897965 (exon 1) is predicted to cause a change of amino acid sequence after residue 12 and termination 19 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories