| Primary Identifier | MGI:6740198 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 4933411K16Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGTCTTCTGTAGTCTCAG and AGCCATAGATTGGGTTTCTG, which resulted in an 863 bp deletion beginning at Chromosome 19 position 42,040,905 bp and ending after 42,041,767 bp (GRCm39/mm39). This mutation deletes 863 bp of ENSMUSE00000897965 (exon 1) is predicted to cause a change of amino acid sequence after residue 12 and termination 19 amino acids later. |
