| Primary Identifier | MGI:6740202 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rassf10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCTTCTCCGAAGGATCCA and TACACAAGGGATTCACACAC, which resulted in a 1510 bp deletion beginning at Chromosome 7 position 112,553,404 bp and ending after 112,554,913 bp (GRCm39/mm39). This mutation deletes 1510 ENSMUSE00001243839 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and termination 11 amino acids later. |
