|  Help  |  About  |  Contact Us

Allele : Creb1<em1Rst> cAMP responsive element binding protein 1; endonuclease-mediated mutation 1, Randal S Tibbetts

Primary Identifier  MGI:6783446 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Creb1
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Glutamic acid codon 153 (GAA) was targeted for change to an aspartic acid codon (GAC)(p.E153D) with an sgRNA (targeting GACTTTTCTTCTTCAATCCTTGG) and an ssODN template using CRISPR/Cas9 technology. This mutation disrupts the BS2 binding site that normally allows binding of protein phosphatase 2A through the PP2A B56 regulatory subunits.
  • mutations:
  • Single point mutation
  • synonyms:
  • Creb<E153D>,
  • Creb<E153D>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories