| Primary Identifier | MGI:6740190 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mrgprb1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTCTTCCGTTGAAACCGA and GATTGCACCACTCCTGAAAA, which resulted in a 776 bp deletion beginning at Chromosome 7 position 48,097,004 bp and ending after 48,097,779 bp (GRCm39/mm39). This mutation deletes 776 bp from ENSMUSE00000593974 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and termination 15 amino acids later. |
