|  Help  |  About  |  Contact Us

Allele : Washc4<em1Ssod> WASH complex subunit 4; endonuclease-mediated mutation 1, Scott H Soderling

Primary Identifier  MGI:6783463 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Washc4
Strain of Origin  (C57BL/6J x SJL/J)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Proline codon 1019 (CCT) in exon 29 was targeted for change to an arginine codon (CGT)(p.P1019R) with an sgRNA (targeting TTGAGAATACTCACAAGAGGAGG) and an ssODN template (ATTTCGAAGGCCAAAGAATATACATCTCCGAAATTTCTATATCATTGTTCGTCCTCTTGTGAGTATTCTCAAAACTAGAAGTGAGTTATTGATGGGTGTTAATACAGATTCAGTTTCCATAAAGCA) using CRISPR/Cas9 technology. The mutation mimics a mutation found in some human Wiskott–Aldrich syndrome patients.
  • mutations:
  • Single point mutation
  • synonyms:
  • SWIP<P1019R>,
  • SWIP<P1019R>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories