|  Help  |  About  |  Contact Us

Allele : Cdkn1a<em1Jcs> cyclin dependent kinase inhibitor 1A; endonuclease-mediated mutation 1, John C Schimenti

Primary Identifier  MGI:6728078 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdkn1a
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  An 11 bp deletion (GGAGCGCGTTC / GAGCGCGTTCG / AGCGCGTTCGG / GCGCGTTCGGA / CGCGTTCGGAG / GCGTTCGGAGC) was created using an sgRNA (targeting ACTTCGTCTGGGAGCGCGTT) with CRISPR/Cas9 technology.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • p21<em1/Jcs>,
  • p21<em1/Jcs>,
  • p21<->,
  • p21<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories