| Primary Identifier | MGI:6810759 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp628 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTGATGGCCGGCTCCCACG and TTCAAAACGTGTGTACCAGT, which resulted in a 3088 bp deletion beginning at Chromosome 7 position 4,921,793 bp and ending after 4,924,880 bp (GRCm39/mm39). This mutation deletes 3088 bp from ENSMUSE00000705973 (exon 3) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 34 amino acids later. |
