|  Help  |  About  |  Contact Us

Allele : Fsip2<em1Nali> fibrous sheath-interacting protein 2; endonuclease-mediated mutation 1, Na Li

Primary Identifier  MGI:6724283 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence, Null/knockout Gene  Fsip2
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A C was inserted into exon 16 (c.8137insC) using an sgRNA (targeting ATCAAGAACAAGTTATCTGCTGG) and an ssODN (AGCAGTACTAAGACCAAAATCAAGAACAAGTTAagcGCTGGAGAGAAAAcCTCCAAGAGAGAGCAGACCAAAACCGCCCTTGGGCTGCCACAAACTCCAC) with CRISPR/Cas9 technology. This mutation mimics a mutation found in multiple morphological abnormalities of the sperm flagella (MMAF) patients. Reduced transcript expression was confirmed by RT-qPCR and absence of peptide expression by immunostaining.
  • mutations:
  • Insertion
  • synonyms:
  • Fsip2-KI,
  • Fsip2-KI
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories