| Primary Identifier | MGI:6724374 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Panx1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 216 (CGG) in exon 4 was targeted for a change to histidine (CAC) (p.R216H) using an sgRNA (targeting GAAATACATTAGCTGCCGGCTGG) and an ssODN (GAGGCTGAAGTAATAGCTCAAGTAGATACATGCCAACAGTATAACCACAAATGTCACCAGGTGGCAGCTAATGTATTTCATGATTAAATGACTAGAGTTCTTTTTTGTCTTCAAGTACTGCTC). The mutated amino-acid is conserved between human and mice and the mutation is found in a patient with symptoms of primary ovarian failure, severe intellectual disability, sensorineural hearing loss, and kyphosis. |
