|  Help  |  About  |  Contact Us

Allele : Panx1<em2Icg> pannexin 1; endonuclease-mediated mutation 2, Institute of Cytology and Genetics

Primary Identifier  MGI:6724374 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Panx1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 216 (CGG) in exon 4 was targeted for a change to histidine (CAC) (p.R216H) using an sgRNA (targeting GAAATACATTAGCTGCCGGCTGG) and an ssODN (GAGGCTGAAGTAATAGCTCAAGTAGATACATGCCAACAGTATAACCACAAATGTCACCAGGTGGCAGCTAATGTATTTCATGATTAAATGACTAGAGTTCTTTTTTGTCTTCAAGTACTGCTC). The mutated amino-acid is conserved between human and mice and the mutation is found in a patient with symptoms of primary ovarian failure, severe intellectual disability, sensorineural hearing loss, and kyphosis.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Panx1<em2Koral/Icg>,
  • Panx1<em2Koral/Icg>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele