| Primary Identifier | MGI:6724340 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ddi1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The single-exon gene was targeted with an sgRNA (targeting GCTGTTCCATGTAAACGATC) using CRISPR/Cas9 technology, resulting in a 26 bp deletion (c.120-145del, p.P41Hfs*8). Western blot and immunohistochemistry experiments confirmed the absence of peptide expression in testes. |
