| Primary Identifier | MGI:6725116 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Kl |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 endonuclease-mediated genome editing is used to introduce encoding a S370C missense mutation (TCC to TGC). Additionally, the following silent nucleotide change was included for targeting efficiency (L370L [CTC to CTT]. Guide RNAs (GACTTTTTTGCTCTCTCCTT and AAAGCTCAAGGTTGGTCCGA) were selected to target position 370 of exon 2. The mutation that corresponds to the human C370 codon associated with late-onset Alzheimer's disease. |
