|  Help  |  About  |  Contact Us

Allele : Kl<em1Adiuj> klotho; endonuclease-mediated mutation 1, MODEL-AD Center

Primary Identifier  MGI:6725116 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Kl
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 endonuclease-mediated genome editing is used to introduce encoding a S370C missense mutation (TCC to TGC). Additionally, the following silent nucleotide change was included for targeting efficiency (L370L [CTC to CTT]. Guide RNAs (GACTTTTTTGCTCTCTCCTT and AAAGCTCAAGGTTGGTCCGA) were selected to target position 370 of exon 2. The mutation that corresponds to the human C370 codon associated with late-onset Alzheimer's disease.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • KL<S370C>,
  • KL-F/C,
  • KL<S370C>,
  • KL-F/C
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele