| Primary Identifier | MGI:6752552 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mb |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The gene was targeted with two gRNAs (targeting GAACTTGTCAAACTTATCCA and CGGTGCAACCATGCTTCTTC) using CRISPR/Cas9 technology, leading to a 199 bp deletion that includes the exon 2 splice acceptor and most of exon 2 (chr15:76901822â76902020 (GRCm39)) in founder 14. This deletion causes the skipping of exon 2 and splicing of exon 1 to 3, which results in a reading frame shift and premature stop codon. |
