|  Help  |  About  |  Contact Us

Allele : Mb<em1Shad> myoglobin; endonuclease-mediated mutation 1, Sean H Adams

Primary Identifier  MGI:6752552 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mb
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  The gene was targeted with two gRNAs (targeting GAACTTGTCAAACTTATCCA and CGGTGCAACCATGCTTCTTC) using CRISPR/Cas9 technology, leading to a 199 bp deletion that includes the exon 2 splice acceptor and most of exon 2 (chr15:76901822–76902020 (GRCm39)) in founder 14. This deletion causes the skipping of exon 2 and splicing of exon 1 to 3, which results in a reading frame shift and premature stop codon.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Mb<->,
  • Mb<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele