| Primary Identifier | MGI:6784017 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ttbk1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCACTGTCGTGGAGAAGCG and TTTCTCCTCAGTAGCCAGAT, which resulted in a 513 bp deletion beginning at Chromosome 17 position 46,789,743 bp and ending after 46,790,255 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000136846, ENSMUSE00000136848 (exons 4,5) and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 27 amino acids later. |
