| Primary Identifier | MGI:6836766 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr118 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Ssh brain enhancer SBE5, in an intron of the Lmbr1 gene, was targeted with sgRNAs (targeting CACCGTGTGCTGTTCACTTCTTGGC, AAACGCCAAGAAGTGAACAGCACAC, CACCGTAAATTATCAATGTACAGGC and AAACGCCTGTACATTGATAATTTAC) using CRISPR/Cas9 technology, resulting in the deletion of the enhancer. |
