| Primary Identifier | MGI:6836768 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fbxo42 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGTTGTAAAGTTAAGCCA and ATTTCCTCCAGACACAGACT, which resulted in a 452 bp deletion beginning at Chromosome 4 position 140,920,700 bp and ending after 140,921,151 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001305721 (exon 5) and 298 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 19 amino acids later. |