|  Help  |  About  |  Contact Us

Allele : Zfp541<em2Osb> zinc finger protein 541; endonuclease-mediated mutation 2, Research Institute for Microbial Diseases, Osaka University

Primary Identifier  MGI:6758968 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp541
Transmission  Germline Strain of Origin  (129S2/SvPas x C57BL/6NSlc)F1-Tg(CAG-EGFP,Acr-EGFP)2Osb
Is Recombinase  false Is Wild Type  false
molecularNote  Sequence upstream of exon 1 and in intron 8 were targeted with a pair of sgRNAs (targeting (2) CTGGTCTCAAGCTCACTAAG and (4) TTATATGCAATACCCAGCAT), resulting in the deletion between sgRNA targets 2 and 4 containing exons 1-8. The ESCs used for the creation of this allele also contain the Tg(CAG-EGFP,Acr-EGFP)2Osb double transgene.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Zfp541 KO,
  • Zfp541<em2Maik>,
  • Zfp541 KO,
  • Zfp541<em2Maik>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories

Trail: Allele