| Primary Identifier | MGI:6764589 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fbrs |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGAGACCGGATTCTCTGCA and AACCTTCTACTCCCATGCCG, which resulted in a 1748 bp deletion beginning at Chromosome 7 position 127,083,557 bp and ending after 127,085,304 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001370970, ENSMUSE00001372570, ENSMUSE00000890591, ENSMUSE00000632361, and ENSMUSE00000632360 (exons 7-11) and 1036 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 347 and early truncation 9 amino acids later. |
